cell lines thp 1 monocytes atcc tib 202 software (ATCC)

ATCC is a verified supplier

ATCC manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

ATCC cell lines thp 1 monocytes atcc tib 202 software
Cell Lines Thp 1 Monocytes Atcc Tib 202 Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 20139 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/cell+lines+thp+1+atcc+tib/THP-1/pm42275226-99-103-107
Average 99 stars, based on 20139 article reviews

cell lines thp 1 monocytes atcc tib 202 software - by Bioz Stars, 2026-09

99/100 stars

Images

Immunohistochemistry:

Article Title: Macrophage-coated tumor cluster aggravates hepatoma invasion and immunotherapy resistance via generating local immune deprivation.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Hepatocyte Specific Antigen Antibody Santa Cruz Cat# sc-58693; RRID:AB_781327 CD68 Monoclonal Antibody (KP1) Invitrogen Cat# 14-0688-82; RRID:AB_11151139 Recombinant Anti-CD8 alpha antibody Abcam Cat# ab237709; RRID:AB_2892677 Anti-Human FAP Antibody Invitrogen Cat# BMS168; RRID:AB_187837 Recombinant Anti-CD31 antibody Abcam Cat# ab76533; RRID:AB_1523298 TREM2 Polyclonal Antibody Invitrogen Cat# PA5-18763; RRID:AB_10984816 Recombinant Anti-FOXP3 antibody Abcam Cat# ab215206; RRID:AB_2860568 Recombinant Anti-CD39 antibody Abcam Cat# ab223842; RRID:AB_2889212 Recombinant Anti-pan Cytokeratin antibody Abcam Cat# ab7753; RRID:AB_306047 Monoclonal Anti-Actin, a-Smooth Muscle Sigma-Aldrich Cat# A2547; RRID:AB_476701 Anti-CD163 antibody Abcam Cat# ab182422; RRID:AB_2753196 Anti-LGALS3BP antibody Abcam Cat# ab217760; RRID: AB_3075495 F4/80 (D2S9R) XP Rabbit mAb Cell Signaling Technology Cat# 70076; RRID:AB_2799771 CD8a (D4W2Z) XP Rabbit mAb Cell Signaling Technology Cat# 98941; RRID:AB_2813554 PE/DazzleTM 594 anti-mouse F4/80 Biolegend Cat# 123146; RRID:AB_2564133 PE anti-mouse/human Mac-2 Biolegend Cat# 125405; RRID:AB_2136764 PE/Cyanine7 anti-mouse CD86 Biolegend Cat# 105013; RRID:AB_439783 APC anti-mouse CD206 Biolegend Cat# 141707; RRID:AB_10900231 FITC anti-mouse TREM2 Invitrogen Cat# MA5-28223; RRID:AB_2745193 PerCP/Cyanine5.5 anti-mouse CD3ε Biolegend Cat# 155616; RRID:AB_2819909 FITC anti-mouse CD4 Biolegend Cat# 116003; RRID:AB_313688 APC/Cyanine7 anti-mouse CD8a Biolegend Cat# 100713; RRID:AB_312753 PE anti-mouse FOXP3 Biolegend Cat# 126403; RRID:AB_1089118 Brilliant Violet 421TM anti-mouse PD-1 Biolegend Cat# 135217; RRID:AB_2562568 PE/Cyanine7 anti-mouse CD39 Biolegend Cat# 143805; RRID:AB_2563393 APC anti-mouse LAG-3 Biolegend Cat# 125209; RRID:AB_10639727 Bacterial and virus strains pHBLV-U6-MCS-EF1-ZsGreen-T2A-Luc Hanbio Biotechnology N/A pHBLV-CMV-MCS-EF1-ZsGreen-T2A-luc Hanbio Biotechnology N/A Biological samples Human HCC tissues Tianjin Medical University Cancer Institute and Hospital N/A Human HCC tissues Xinchao Biotechnology N/A Human HCC tissues Yaxiang Biotechnology N/A Human breast cancer tissues Tianjin Medical University Cancer Institute and Hospital N/A Human lung squamous carcinoma tissues Tianjin Medical University Cancer Institute and Hospital N/A Chemicals, peptides, and recombinant proteins ProLong Gold Antifade Reagent Invitrogen Cat# P36930 Recombinant Human IL-8 (CXCL8) PeproTech Cat# 200-08 (Continued on next page) e1 Cell Reports Medicine 5, 101505, May 21, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER GB1107 MedChemExpress Cat# HY-114409 Cell TrackerTM Red CMTPX Dye Invitrogen Cat# C34552 InVivoMAb anti-mouse PD-1 BioXCell Cat# RMP1-14 Collagenase IV GlpBio Cat# GC19591 DNase I GlpBio Cat# GC19804 Zombie AquaTM Fixable Viability Kit Biolegend Cat# 423101 Critical commercial assays Opal 4-Color Manual IHC Kit AKOYA Biosciences Cat# NEL810001KT Opal 7-Color Manual IHC Kit AKOYA Biosciences NEL871001KT Deposited data scRNA-seq This paper GEO: GSE248907 Experimental models: Cell lines THP-1 ATCC TIB-202; RRID:CVCL_0006 MHCC97L Cellcook Biotech Co. N/A; RRID:CVCL_4973 MHCC97H Cellcook Biotech Co. N/A; RRID:CVCL_4972 Hepa1-6 ATCC CRL-1830; RRID:CVCL_0327 Experimental models: Organisms/strains Mouse: C57BL/6 Jiangsu GemPharmatech N/A Oligonucleotides Primer Human M2BP Forward 50- CAATGGTACTTCTACTCCCGAA-30 This paper N/A Primer Human M2BP Reverse 50- GAACTGTAGGCAGAGCTTCTC-30 This paper N/A Primer Mouse M2BP Forward 50- CTTCTCGTGTACCTCTAACGAG-30 This paper N/A Primer Mouse M2BP Reverse 50- CTGTTCTCATAGCCAATTGTCG -30 This paper N/A Human ACTB Endogenous Reference Genes Primers Sangon Biotech B661102 Mouse ACTB Endogenous Reference Genes Primers Sangon Biotech B661302 Software and algorithms StrataQuest Image Analysis software TissueGnostics https://tissuegnostics.com/products/ contextual-image-analysis/ strataquest-apps Cell Ranger software (v6.0.2) 10X Genomics https://support.10xgenomics.com/ singlecell-gene-expression/software Scanpy (version 1.9.3) https://pypi.org/project/scanpy/ https://pypi.org/project/scanpy/ Harmony Korsunsky et al.41 https://github.com/immunogenomics/ harmony Leiden algorithm Traag et al.42 N/A SPSS 16.0 https://www.ibm.com/products/ spss-statistics https://www.ibm.com/products/ spss-statistics GraphPad Prism 8 GraphPad https://www.graphpad.com/features FlowJo v10.9 FlowJo LLC https://www.flowjo.com MedCalc software https://www.medcalc.org/ https://www.medcalc.org/ OPEN ACCESS ..

Article Title: Macrophage-coated tumor cluster aggravates hepatoma invasion and immunotherapy resistance via generating local immune deprivation
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Hepatocyte Specific Antigen Antibody Santa Cruz Cat# sc-58693; RRID:AB_781327 CD68 Monoclonal Antibody (KP1) Invitrogen Cat# 14-0688-82; RRID:AB_11151139 Recombinant Anti-CD8 alpha antibody Abcam Cat# ab237709; RRID:AB_2892677 Anti-Human FAP Antibody Invitrogen Cat# BMS168; RRID:AB_187837 Recombinant Anti-CD31 antibody Abcam Cat# ab76533; RRID:AB_1523298 TREM2 Polyclonal Antibody Invitrogen Cat# PA5-18763; RRID:AB_10984816 Recombinant Anti-FOXP3 antibody Abcam Cat# ab215206; RRID:AB_2860568 Recombinant Anti-CD39 antibody Abcam Cat# ab223842; RRID:AB_2889212 Recombinant Anti-pan Cytokeratin antibody Abcam Cat# ab7753; RRID:AB_306047 Monoclonal Anti-Actin, a-Smooth Muscle Sigma-Aldrich Cat# A2547; RRID:AB_476701 Anti-CD163 antibody Abcam Cat# ab182422; RRID:AB_2753196 Anti-LGALS3BP antibody Abcam Cat# ab217760; RRID: AB_3075495 F4/80 (D2S9R) XP Rabbit mAb Cell Signaling Technology Cat# 70076; RRID:AB_2799771 CD8a (D4W2Z) XP Rabbit mAb Cell Signaling Technology Cat# 98941; RRID:AB_2813554 PE/DazzleTM 594 anti-mouse F4/80 Biolegend Cat# 123146; RRID:AB_2564133 PE anti-mouse/human Mac-2 Biolegend Cat# 125405; RRID:AB_2136764 PE/Cyanine7 anti-mouse CD86 Biolegend Cat# 105013; RRID:AB_439783 APC anti-mouse CD206 Biolegend Cat# 141707; RRID:AB_10900231 FITC anti-mouse TREM2 Invitrogen Cat# MA5-28223; RRID:AB_2745193 PerCP/Cyanine5.5 anti-mouse CD3ε Biolegend Cat# 155616; RRID:AB_2819909 FITC anti-mouse CD4 Biolegend Cat# 116003; RRID:AB_313688 APC/Cyanine7 anti-mouse CD8a Biolegend Cat# 100713; RRID:AB_312753 PE anti-mouse FOXP3 Biolegend Cat# 126403; RRID:AB_1089118 Brilliant Violet 421TM anti-mouse PD-1 Biolegend Cat# 135217; RRID:AB_2562568 PE/Cyanine7 anti-mouse CD39 Biolegend Cat# 143805; RRID:AB_2563393 APC anti-mouse LAG-3 Biolegend Cat# 125209; RRID:AB_10639727 Bacterial and virus strains pHBLV-U6-MCS-EF1-ZsGreen-T2A-Luc Hanbio Biotechnology N/A pHBLV-CMV-MCS-EF1-ZsGreen-T2A-luc Hanbio Biotechnology N/A Biological samples Human HCC tissues Tianjin Medical University Cancer Institute and Hospital N/A Human HCC tissues Xinchao Biotechnology N/A Human HCC tissues Yaxiang Biotechnology N/A Human breast cancer tissues Tianjin Medical University Cancer Institute and Hospital N/A Human lung squamous carcinoma tissues Tianjin Medical University Cancer Institute and Hospital N/A Chemicals, peptides, and recombinant proteins ProLong Gold Antifade Reagent Invitrogen Cat# P36930 Recombinant Human IL-8 (CXCL8) PeproTech Cat# 200-08 (Continued on next page) e1 Cell Reports Medicine 5, 101505, May 21, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER GB1107 MedChemExpress Cat# HY-114409 Cell TrackerTM Red CMTPX Dye Invitrogen Cat# C34552 InVivoMAb anti-mouse PD-1 BioXCell Cat# RMP1-14 Collagenase IV GlpBio Cat# GC19591 DNase I GlpBio Cat# GC19804 Zombie AquaTM Fixable Viability Kit Biolegend Cat# 423101 Critical commercial assays Opal 4-Color Manual IHC Kit AKOYA Biosciences Cat# NEL810001KT Opal 7-Color Manual IHC Kit AKOYA Biosciences NEL871001KT Deposited data scRNA-seq This paper GEO: GSE248907 Experimental models: Cell lines THP-1 ATCC TIB-202; RRID:CVCL_0006 MHCC97L Cellcook Biotech Co. N/A; RRID:CVCL_4973 MHCC97H Cellcook Biotech Co. N/A; RRID:CVCL_4972 Hepa1-6 ATCC CRL-1830; RRID:CVCL_0327 Experimental models: Organisms/strains Mouse: C57BL/6 Jiangsu GemPharmatech N/A Oligonucleotides Primer Human M2BP Forward 50- CAATGGTACTTCTACTCCCGAA-30 This paper N/A Primer Human M2BP Reverse 50- GAACTGTAGGCAGAGCTTCTC-30 This paper N/A Primer Mouse M2BP Forward 50- CTTCTCGTGTACCTCTAACGAG-30 This paper N/A Primer Mouse M2BP Reverse 50- CTGTTCTCATAGCCAATTGTCG -30 This paper N/A Human ACTB Endogenous Reference Genes Primers Sangon Biotech B661102 Mouse ACTB Endogenous Reference Genes Primers Sangon Biotech B661302 Software and algorithms StrataQuest Image Analysis software TissueGnostics https://tissuegnostics.com/products/ contextual-image-analysis/ strataquest-apps Cell Ranger software (v6.0.2) 10X Genomics https://support.10xgenomics.com/ singlecell-gene-expression/software Scanpy (version 1.9.3) https://pypi.org/project/scanpy/ https://pypi.org/project/scanpy/ Harmony Korsunsky et al.41 https://github.com/immunogenomics/ harmony Leiden algorithm Traag et al.42 N/A SPSS 16.0 https://www.ibm.com/products/ spss-statistics https://www.ibm.com/products/ spss-statistics GraphPad Prism 8 GraphPad https://www.graphpad.com/features FlowJo v10.9 FlowJo LLC https://www.flowjo.com MedCalc software https://www.medcalc.org/ https://www.medcalc.org/ Article ll OPEN ACCESS ..

Software:

Transfection:

Article Title: MALAT1 regulates human macrophage metabolism by interacting with HADHB.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER HiPerFect Transfection Reagent Qiagen Cat# 301705 DMEM/F-12 Gibco Cat# 11320033 DMEM, high glucose Gibco Cat# 11965092 Recombinant Mouse M-CSF (carrier-free) Biolegend Cat# 576406 Lenti-X Concentrator Takara Cat# 631232 Lipofectamin 2000 Thermofisher Cat# 11668019 Critical commercial assays RNeasy Mini Kits Qiagen Cat# 74106 SuperScript III First-Strand Synthesis System Invitrogen Cat# 18080051 Magna RIP RNA-Binding Protein Immunoprecipitation Kit Merck Cat# 17-700 Takara BCA Protein Assay Kit Takara Cat# T9300A PARIS Kit Inovitrogen Cat# AM1921 Qproteome Mitochondria Isolation Kit Qiagen Cat# 37612 NEBNext Ultra II RNA Library Prep Kit NEB Cat# E7770L L-lactate Assay Kit (Colorimetric) Abcam Cat# ab65331 Deproteinizing Sample Preparation Kit-TCA Abcam Cat# ab204708 MycoFluor Mycoplasma Detection Kit Thermo Fisher Cat# M7006 Deposited data RIP-seq data Gene Expression Omnibus [Database]: GSE281530 RNA-seq data Gene Expression Omnibus [Database]: GSE281531 Experimental models: Cell lines THP-1 ATCC TIB-202; RRID: CVCL_0006 RAW 264.7 ATCC TIB-71; RRID: CVCL_0493 BMDM Freshly Isolated In Mouse Kupffer Cells Freshly Isolated In Mouse .. Experimental models: Organisms/strains Mouse: WT C57BL/6NJ Oriental Yeast Company (Tokyo, Japan) In Bred; RRID: IMSR_JAX:005304 Oligonucleotides Silencer Select Pre-desigened siRNA of MALAT1:siMALAT1#1, 5 ′ - CCGCUGCUAUUAGAAUGCATT-3 ′ (sense) Ambion siRNA ID: n511399 Silencer Select Pre-desigened siRNA of MALAT1:siMALAT1#1, 5 ′ - UGCAUUCUAAUAGCAGCGGGA-3 ′ (antisense) Ambion siRNA ID: n511399 Silencer Select Pre-desigened siRNA of MALAT1:siMALAT1#2, 5 ′ - GGCUUAUACUCAUGAAUCUTT-3 ′ (sense) Ambion siRNA ID: n272231 Silencer Select Pre-desigened siRNA of MALAT1:siMALAT1#2, 5 ′ - AGAUUCAUGAGUAUAAGCCTG-3 ′ (antisense) Ambion siRNA ID: n272231 Silencer Select Negative Control#1 siRNA Ambion Cat# 4390843 Silencer Select Pre-desigened siRNA of Malat1: siMalat1#1, 5 ′ - CAGCUAGCAUGUGAUGUAATT-3 ′ (sense) Ambion siRNA ID: n520782 Silencer Select Pre-desigened siRNA of Malat1: siMalat1#1, 5 ′ - UUACAUCACAUGCUAGCUGCT-3 ′ (antisense) Ambion siRNA ID: n520782 (Continued on next page) e2 iScience 29, 115107, March 20, 2026

Recombinant:

RNA Binding Assay:

Immunoprecipitation:

Bicinchoninic Acid Protein Assay:

Isolation:

Sample Prep:

Gene Expression:

RNA Sequencing:

other:

Article Title: Boron-Based Inhibitors of the NLRP3 Inflammasome
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited Data Crystal structure NBC6 This paper Cambridge Crystallographic Data Centre CCDC 1563191 Crystal structure NBC11 This paper Cambridge Crystallographic Data Centre CCDC 1563192 Experimental Models: Cell Lines THP-1 ATCC TIB-202 Primary mouse peritoneal macrophages Brough lab, UoM Primary mouse BMDMs Brough lab UoM ASC-mCherry BMDMs Brough lab UoM HepG2 ATCC HB-8065 HEK293 ATCC CRL-1573 Experimental Models: Organisms/Strains C57BL/6 mice Envigo NLRP3 knockout mice Genentech Software and Algorithms SYBYL-X 2.1 Tripos Inc https://www.certara.com/software/molecular- modeling-and-simulation/sybyl-x-suite/ GraphPad Prism version 7.00 for Windows GraphPad Software www.graphpad.com R 3.30 R Foundation for Statistical Computing http://www.R-project.org/ Gaussian 09 Gaussian, Inc http://gaussian.com/ Omega 2.5.1.4 OpenEye Scientific Software https://www.eyesopen.com/ ROCS 3.0.0 OpenEye Scientific Software https://www.eyesopen.com/ OSIRIS DataWarrior 4.5.2 Actelion Pharmaceuticals Ltd http://www.openmolecules.org/datawarrior/

Review